Chapter 4: Cellular Metabolism

Chapter 4: Cellular Metabolism

CELLULAR METABOLISM BIO 137 Anatomy & Physiology I Metabolism The total of all chemical reactions in an organism that are necessary to maintain life Includes synthesis and breakdown of molecules These reactions are usually stepwise and are called metabolic pathways 2 Processes in Metabolism Catabolism Anabolism Metabolic Pathways Catabolism Breakdown of larger molecules through Hydrolysis Exergonic (energy can be used to drive anabolic pathways) Example: oxidation (breakdown) of glucose in cellular respiration

Metabolic Pathways Anabolism Construction of larger molecules (polymers) from monomers through Dehydration Endergonic requires energy Example: building a polypeptide chain and protein from amino acids Metabolic Pathways Reactant(s) Product(s) Stepwise Each step in a pathway is catalyzed by a specific enzyme Enzymes are protein catalysts A substrate is what an enzyme acts on Each enzyme is specific for a substrate Enzyme 1 A Enzyme 3 D

C B Reaction 1 Starting molecule Enzyme 2 Reaction 2 Reaction 3 Product Activation Energy, EA In a chemical reaction, bonds are broken in reactants, requiring an initial energy investment EA amount of energy needed to break bonds in reactants EA is usually heat from surroundings Enzymes Enzymes are protein catalysts that speed up the rate of a

reaction without being consumed Enzymes are necessary because most reactions proceed very slowly and metabolism would be hindered A single enzyme can catalyze thousands of reactions a second Enzyme-Substrate Binding Enzymes are PROTEINS with specific 3-dimensional conformations (shape) Shape of enzyme determines function (what substrate it will bind) Active site region of an enzyme that binds a substrate Substrate fits active site, forming enzyme-substrate complex Lock and key model In this form, enzyme converts substrate to product** Catalytic Cycle of an Enzyme 1 Substrates enter active site; enzyme changes shape so its active site embraces the substrates (induced fit).

Substrates Enzyme-substrate complex Active site s available for wo new substrate molecules. Enzyme 5 Products are Released. Products 2 Substrates held in active site by weak interactions, such as hydrogen bonds and ionic bonds. 3 Active site (and R groups o its amino acids) can lower EA and speed up a reaction by

acting as a template for substrate orientation, stressing the substrates and stabilizing the transition state, providing a favorable microenvironment, participating directly in the catalytic reaction. 4 Substrates are Converted into Products. Enzyme Activity is affected by Environment Enzymes have optimal conditions under which they work Optimal conditions favor correct conformation Any physical or chemical condition that affects an enzymes 3-dimensional shape can affect enzyme activity Temperature, pH, chemicals These conditions can change protein conformation =

Denaturation Makes an enzyme inactive WHY DO WE CARE SO MUCH ABOUT ENZYMES? Enzyme regulation is vital to the control of metabolism. Metabolic Regulation Metabolism is controlled by regulation of enzyme activity 1. Alter gene expression of enzyme 2. Regulate enzymes already present in a cell (Allosteric Regulation) Energy Energy is defined as the capacity to do work Includes kinetic energy and potential energy Energy can be transformed from one form to another Energy is used to fuel cellular work Forms of Energy Kinetic Energy Energy of motion Light (photosynthesis), heat (random movement of atoms and

molecules), Pool cue Potential Energy (PE) Stored energy due to location or structure Chemical Energy PE stored in molecules as a result of the arrangement of atoms in the molecule Free Energy & Metabolism Chemical reactions can be classified based on how energy is used Exergonic Energy is given off in the reaction Spontaneous Endergonic Energy is required to start the reaction Not spontaneous Energy and Metabolism Nutrients have potential energy (chemical energy) due to

the arrangement of atoms Electrons in the bonds holding atoms together represent energy!! Energy can be given off when nutrients are broken down Chemical energy in glucose is converted to ATP energy during Cellular Respiration Electrons and Energy Loss of electrons in nutrients as they are broken down allows for the production of ATP Very complicated, do not focus on details Know that electrons represent stored energy Electrons are shuttled in a cell by electron carriers and ultimately given to O2, making H2O CO2 is lost in several steps along the way Waste product of metabolism ATP Adenosine Triphosphate Energy molecule of our

cells Cells that require energy to perform functions use ATP for that energy Composed of 3 parts: Adenine molecule Ribose molecule 3 phosphate groups in a chain Cellular Respiration Breakdown of nutrients in the presence of oxygen (aerobic) to yield ATP Involves shuttling of electrons from food to oxygen C6H12O6 + 6 O2 6CO2 + 6H2O + (38 ATP) Breakdown is stepwise Carbohydrate Metabolism Glucose is not just an example we happen to

choose it is indeed the bodys preferred source of fuel During digestion, polysaccharides and disaccharides are hydrolyzed into the monosaccharides glucose (80%), fructose, and galactose These three monosaccharides are absorbed into the villi of the small intestine and carried to the liver hepatocytes convert galactose and fructose to glucose Cellular Respiration 3 major steps Glycolysis Initial breakdown of glucose Cytosol, anaerobic Citric Acid Cycle (Krebs) Matrix of mitochondria, aerobic Electron Transport Chain (Oxidative Phosphorylation) Cristae of mitochondria, aerobic

This is where those electrons are used! Glycolysis Glucose, C6H12O6, is broken down into 2- pyruvate molecules (3C) Stepwise, where electrons are given off to electron carriers These are used in the Electron Transport Chain Occurs in the cytosol under Anaerobic conditions ATP is both consumed and made here Fig. 4.10 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Glucose Phase 1 priming

Carbon atom P Phosphate 2 ATP 2 ADP Fructose-1,6-diphosphate P P Phase 2 cleavage Glycolysi s Dihydroxyacetone phosphate P Phase 3 oxidation and formation of ATP and release of high energy electrons Glyceraldehyde

phosphate P P 2 NAD+ 4 ADP 2 NADH + H+ 4 ATP 2 Pyruvic acid Net O2 O2 2 NADH + H+ 2 NAD+ 2 Lactic acid To citric acid cycle and electron transport chain (aerobic pathway)

Citric Acid Cycle (Krebs) Cycle where starting reactants are regenerated Cycle is completed 2X per glucose molecule Stepwise, where electrons are given off to electron carriers These are used in the Electron Transport Chain ATP is made CO2 is formed as waste RECALL THAT ELECTRONS REPRESENT STORED ENERGY Now we will use that stored energy to make ATP! Electron Transport Chain **Energy found in electron carriers is now used to make ATP through oxidative phosphorylation Occurs on mitochondrial cristae Electrons are ultimately given to Oxygen and water is formed

Energy given off during this process is used to make ATP! Electron Transport Chain Fig. 4.8 ATP Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. P Energy transferred from cellular respiration used to reattach phosphate P P ATP P ADP P

P Energy transferred and utilized by metabolic reactions when phosphate bond is broken P Fermentation If oxygen is not present after glycolysis, pyruvate is fermented Alcohol Fermentation Lactic Acid Fermentation Yeasts and some bacteria In animals Pyruvate is converted to Pyruvate is converted to

ethanol lactic acid Accumulates and causes muscle fatigue and soreness Fermentation P 2 ADP + 2 Glucose 2 ATP i Glycolysis O C O

C O CH3 2 Pyruvate 2 NADH +2 H+ 2 NAD+ H 2 CO2 H H C OH C O CH3 CH3 2 Acetaldehyde

2 Ethanol (a) Alcohol fermentation 2 ADP + 2 Glucose P i 2 ATP Glycolysis O C 2 NAD+ O C O H C

OH CH3 2 Lactate (b) Lactic acid fermentation 2 NADH O C O CH3 2 Pyruvate Carbohydrate Storage Excess glucose is stored as glycogen (liver and muscle cells) Can be converted to fat and amino acids BREAKDOWN BUILD UP

4-22 Fig. 4.15 4.15 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Food Catabolism of proteins, fats and carbohydrates Proteins (egg white) Carbohydrates (toast, hashbrowns) Amino acids Fats (butter)

Simple sugars (glucose) Glycerol Glycolysis 1 Breakdown of large macromolecules to simple molecules 2 Breakdown of simple molecules to acetyl coenzyme A accompanied by production of limited ATP and high energy electrons 3

Complete oxidation of acetyl coenzyme A to H2O and CO2 produces high energy electrons (carried by NADH and FADH2), which yield much ATP via the electron transport chain Fatty acids ATP Pyruvic acid Acetyl coenzyme A Citric acid cycle CO2 ATP High energy

electrons carried by NADH and FADH2 Electron transport chain ATP 2e and 2H+ NH2 O2 CO2 H2O Waste products Royalty Free/CORBIS. Central Dogma Transcription DNA

Translation RNA Protein Replication DNA sequence contains information to direct protein synthesis (MAKE A PROTEIN) Genetics Genetic information inherited from our parents is found in our DNA Gene Sequence of DNA nucleotides that codes for a protein DNA sequence contains information to direct protein synthesis Gene product = A protein Genetics A Protein performs the function of the gene

All of the DNA in a cell constitutes its genome DNA Structure DNA is composed of nucleotides DNA Nucleotide: Deoxyribose sugar Phosphate group Nitogen containing base PURINE Adenine, A Guanine, G PYRIMIDINE Cytosine, C Thymine, T DNA Structure DNA is double stranded Each strand is composed of repeating nucleotides Joined together by

hydrogen bonds between complimentary bases A binds T (2 H-bonds) G binds C (3 H-bonds) Sugar-phosphate backbone Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Hydrogen bonds P P Fig. 4.19a CC G Thymine (T) Adenine (A)

Cytosine (C) Guanine (G) P P (a) TT P P P CC GG P P P C P

G P A P G C A Nucleotide strand G C T C G A Segment

of DNA molecule DNA Replication Occurs in the nucleus DNA unwinds and is replicated before a cell divides Makes an identical copy of DNA using parental DNA as a template DNA Replication DNA Replication is semi-conservative Resulting DNA is half-old, half-new Parental DNA (template) and newly synthesized DNA DNA Polymerase enzyme responsible for addition of nucleotides A binds T (2 H-bonds) G binds C (3 H-bonds) DNA Replication Replication Example TACAGTCCATTCACCTAGGATATT

Ribonucleic Acid RNA is also composed of nucleotides Ribose sugar Phosphate group Bases A, Uracil (U) C, G RNA STRUCTURE RNA is single stranded An RNA copy of DNA is made during Transcription Comparison of DNA & RNA DNA Sugar Bases

# of Strands RNA Types of RNA Messenger RNA, mRNA Carries code (message) for protein to be synthesized Transfer RNA, tRNA Carries appropriate amino acid to ribosome to be incorporated into protein Ribosomal RNA, rRNA The RNA component of the ribosome (recall that a ribosome is

composed of RNA plus protein) Transcription Occurs in the nucleus Make a messenger RNA copy of the DNA (gene) RNA Polymerase enzyme copies the DNA Base Pairing DNA RNA A U T A C G G C Transcription **Only transcribe a gene when it is needed All cells have the same genes but have differential

expression of those genes Transcription Transcribe the following DNA sequence: TACAGTCCATTCACCTAGGATATT Following transcription, the mRNA leaves the nucleus and enters the cytosol where it is threaded through a ribosome to undergo translation. Translation mRNA is translated into protein Occurs on the ribosome mRNA is read 3 bases at a time These are called codons Each codon corresponds to an amino acid The Genetic Code There are 64 codons that make up the genetic

code Each codon corresponds to an amino acid 20 amino acids in nature Code is redundant 1 START codon: AUG 3 STOP codons: UAA, UAG, UGA Amino acids are attached to a specific tRNA tRNA carries the amino acid to the growing polypeptide chain Genetic Code Translation 1st codon of every gene is always AUG START codon Translation begins at AUG Translation ends when a STOP codon is reached UAA, UAG, UGA Remember, Amino acids are attached to a specific tRNA

Has anticodon sequence If mRNA is UAA, tRNA anticodon is AUU Translate the mRNA sequence from before Translation Each time a codon is read, a new amino acid is added to a growing chain Peptide bonds form between each amino acid When a STOP codon is reached, the protein is released Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 1 Fig. 4.24 2 Growing

The transfer RNA molecule polypeptide for the last amino acid added chain holds the growing polypeptide Anticodon chain and is attached to its complementary codon on mRNA. A U G G G C U 1 2 3 4 Next amino acid 5 6 Transfer RNA U G C C G U

C C G C A A C G G C A G G C A A G C G U 3 4 5 6 Messenger RNA 7 Codons Peptide bond 1 2 2

Growing polypeptide chain 3 A second tRNA binds complementarily to the next codon, and in doing Anticodon so brings the next amino acid into position on the ribosome. A U G G G C U C A peptide bond forms, linking the new amino acid to the growing polypeptide chain. 1 2 3 4 Next amino acid 5

6 Transfer RNA U G C C G U C G C A A C G G C A G G C A A G C G U 4 5 6 Messenger RNA 7 Codons 1 3 The tRNA molecule that brought the last amino acid to the ribosome is released

to the cytoplasm, and will be used again. The ribosome moves to a new position at the next codon on mRNA. 2 3 4 5 C U G 7 6 C C G Next amino acid Transfer

RNA C G U A U G G G C U C C G C A A C G G C A G G C A A G C G U 1 2 3 4 5 6 7 Messenger RNA Ribosome

1 2 4 A new tRNA complementary to 3 4 the next codon on mRNA brings the next amino acid to be added to the growing polypeptide chain. 5 6 7 C G U C C G Next amino acid Transfer

RNA A U G G G C U C C G C A A C G G C A G G C A A G C G U 1 2 3 4 5 6 7 Messenger RNA Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Cytoplasm

DNA double helix T Nucleus T A G A G T C T G A C A

T A C A G C DNA strands pulled apart T A T T U A

G G G C G G C T C A C A A C C C

T G G G A C C A G G T A G A

T G C T C T G A C C C A A T U

G G A A C A T A T C G C G C C

G A T C C T Direction of reading Nuclear pore G C C G A G

G T A 1 DNA information is copied, or transcribed, into mRNA following complementary base pairing moves along the mRNA, more amino acids are added Messenger C RNA G

4 As the ribosome G G T A C G C G G U T C A

C G C C G G G A C Transcription (in nucleus) the ribosome releases the new protein G

C C Direction of reading C G A G T 5 At the end of the mRNA G U C C A

G T C C T G Amino acids recognize complementary mRNA codons, attached to tRNA thus bringing the correct amino acids into position on the growing polypeptide chain 6 tRNA molecules 2 mRNA leaves Polypeptide can pick up anoth the nucleus chain molecule of the Messenger and attaches same amino acid RNA

to a ribosome and be reused C G C 3 Translation begins as tRNA anticodons G C G T C A G G C C

DNA strand Translation (in cytoplasm) G C U A G C Direction of reading Amino acids represented A U G G G C U C C

G C A A C G G C A G G C Codon 1 Methionine Codon 2 Glycine Codon 3 Serine Codon 4 Alanine

Codon 5 Threonine Codon 6 Alanine Codon 7 Glycine Mutations Result from an error in DNA sequence Caused by many things: Chemicals, error in replication, sunlight, X-rays Mutations affect the protein product of a gene Not made Made, but wrong conformation Non-functional Protein Made in excess Mutations Affect Protein Product Sickle-cell anemia Results from a single amino acid change in the gene that codes

for hemoglobin This defect causes RBCs to become sickle-shaped in low oxygen situations Mutations Affect Protein Product Non-functional protein Hemoglobin in Sickle Cell Trait/Anemia CFTR pump in Cystic Fibrosis Wild-type hemoglobin DNA 3 Mutant hemoglobin DNA 5 C T T In the DNA, the mutant template strand has an A where the wild-type template has a T.

G U A The mutant mRNA has a U instead of an A in one codon. 3 5 T C A mRNA mRNA G A A 5 3

5 3 Normal hemoglobin Sickle-cell hemoglobin Glu Val The mutant (sickle-cell) hemoglobin has a valine (Val) instead of a glutamic acid (Glu). Light Micrograph Sickle Cell Anemia RBCs

Recently Viewed Presentations

  • The Compelling Display of Data to Achieve Desired

    The Compelling Display of Data to Achieve Desired

    DRILL BIT STUCK IN PAN DECK-TWISTED R-SHOULDER. breaking a plug loose on heavy equipment, smashed Right hand. CO-WORKER SLAMMED R HAND IN TRUCK DOOR. JUMPED FROM LADDER-TWISTED R NECK/SHOULDER. slipped/fell on stairs entering water lab, inj. LT shoulder
  • Personal Health Information Protection Act, 2004: An Overview

    Personal Health Information Protection Act, 2004: An Overview

    Times New Roman Tahoma Arial CommonBullets Default Design Personal Health Information Protection Act, 2004: An Overview BACKGROUND PAST ONTARIO CONSULTATIONS TIMELINE BILL 31 SCHEDULES UNDERLYING PRINCIPLES ORGANIZATION OF PHIPA SCOPE OF PHIPA WHO IS A HEALTH INFORMATION CUSTODIAN (s.3, p.8)?...
  • Framework - Eastern Illinois University

    Framework - Eastern Illinois University

    Different services have different weaknesses Host's operating system, version number, etc. Whois database at NetworkSolutions.com also used when ping scans fail Social engineering Tricking employees into giving out info (passwords, keys, etc.) Deciding the type of attacks to launch given...
  • Morphosyntax - edisciplinas.usp.br

    Morphosyntax - edisciplinas.usp.br

    Definiteness: a 2-part system pertaining to nouns (definite/indefinite) Each choice can be marked by changes in the form/inflection of words and/or what they combine with. Case: definiiton. Case canbedefined as thefunctionof a NP in relation to a VP oranother NP.
  • Map Reading & Navigation

    Map Reading & Navigation

    Map Reading & Navigation Presentation Overview Types of maps used within SES How to use various maps Scale, Grid references, Ground shape, Gradient etc Compasses & Bearings Cross country navigation Remote area preparedness - (supplement) Aim of Map Reading...
  • Madit-rit: Background

    Madit-rit: Background

    madit-rit: background ICD is highly effective in reducing mortality in high-risk cardiac pts. Despite sophisticated device-detection algorithms, 8-40% of ICD therapies are inappropriate with adverse side effects
  • Nuclease Digestion - botany.ubc.ca

    Nuclease Digestion - botany.ubc.ca

    Unit 3: Interphase Nucleus ... Step 1 of Digestion Chromatin is exposed to nuclease digestion. The timing of the digestion is such that not every stretch of linking DNA is digested. Step 2 The incomplete digestion of chromatin results in...
  • The World of the Angels - Yola

    The World of the Angels - Yola

    The angels will ask the dead person about his Lord, his Prophet, and his religion. The believers will answer confidently and correctly, therefore, they will enjoy a happy time in the grave. The disbelievers will not be able to answer...